proprietary assay design software  (BIOTAGE)

Journal: BMC Medical Genetics

Article Title: A mitotic recombination map proximal to the APC locus on chromosome 5q and assessment of influences on colorectal cancer risk

doi: 10.1186/1471-2350-10-54

Figure Lengend Snippet: Typing hap1 and hap2 allelotypes using the Pyrosequencing assay . The plots show the bins used to call hap1/hap1, hap1/hap2 and hap2/hap2 allelotypes based on C:T ratio frequencies in our whole case and control group. The trimodal distribution corresponding to the three genotypes was evident with ratio bins of 0.05, but finer demarcation between the ratios, especially the hap1/hap2 versus hap1/hap1 groups, was possible using bins of 0.01 which showed a minimum frequency of calls at a T allele proportion of 0.38–0.39. The T allele proportion bins used to score allelotypes were therefore: hap2/hap2, 0.0–0.1; hap1/hap2, 0.15–0.37; hap1/hap1, 0.39–1.0. The remaining samples (< 1%) were excluded. There was no significant departure of genotype frequencies from Hardy-Weinberg equilibrium (χ 2 1 = 3.55, P = 0.07).

Article Snippet: Briefly, primers were designed using the proprietary Pyrosequencing assay design software, giving: (i) biotinylated forward PCR primer, TCCTTTATTTTCCTTACAGGGTTT; (ii) reverse PCR primer, ATGCTGGCAGACTTACTCCTTAAT; and sequencing primer, TCCTTCTTTTTGATTTTGT.

Techniques: Pyrosequencing Assay, Control